View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13008_low_4 (Length: 270)
Name: NF13008_low_4
Description: NF13008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13008_low_4 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 17 - 270
Target Start/End: Complemental strand, 43562534 - 43562283
Alignment:
| Q |
17 |
aaaatccaatcctctcttcatacttttctgtttcttttaccgtgttgatttcatcacttacatagttatatctttttcttcatgnnnnnnnnccaacctt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
43562534 |
aaaatccaatcctctcttcatacttttctgtttcttttaccgtgttgatttcatcacttatatagttatatctttttcttcc--gtttttttccaacctt |
43562437 |
T |
 |
| Q |
117 |
tgaaatttgcatttccaatagtggaatatactattggtgggttaagggtcactatatcttatgtctaagagtattttatggacatccatttttccataca |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| || |||||||||||||||| |
|
|
| T |
43562436 |
tgaaatttgcacttccaatagtggaatatactattggtgggttaagggtcactatatcttgtgtctaacagtattttatgaacgtccatttttccataca |
43562337 |
T |
 |
| Q |
217 |
cccatctgacacatgttaatcacgtctaaaaatatagttaactaagtcggttag |
270 |
Q |
| |
|
|| || ||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43562336 |
ccgatgtgatacatgttaatcacgtctaaaaatatagttaactcagtcggttag |
43562283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University