View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13009_low_2 (Length: 245)
Name: NF13009_low_2
Description: NF13009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13009_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 16 - 226
Target Start/End: Complemental strand, 7463723 - 7463510
Alignment:
| Q |
16 |
tgtgtaaacagtttagtttagttgatttaac---tcattagtgtatttaaatgaagtttcatacgagtatatgcacgtgaaaatttgcaaggagctttgc |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7463723 |
tgtgaaaacagtttagtttagttgatttaacaattcattagtgtatttaaatgaagtttcatacgagtatatgcacgtgaaaatttgcaaggagctttgc |
7463624 |
T |
 |
| Q |
113 |
tcatgtgaaaacaacattatttaacaaaaatacgaatacgaaacaannnnnnncctataacaaaattagcaacaatatagtgaaattaatttaaaaagcg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7463623 |
ccatgtgaaaacaacattatttaacaaaaatacgaatacgaaacaatttttttcctattacaaaattagcaacaatatagtgaaattaatttaaaaagtg |
7463524 |
T |
 |
| Q |
213 |
acaacctaggctgg |
226 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7463523 |
acaacctaggctgg |
7463510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University