View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1300_high_6 (Length: 391)
Name: NF1300_high_6
Description: NF1300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1300_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 29 - 381
Target Start/End: Complemental strand, 10008238 - 10007886
Alignment:
| Q |
29 |
agtatctatatcaagcacagttaatattgcatatcaaataggcagtatatgtactcgtccaagagattgtgagtcaggtttgccatctacagctcactgt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10008238 |
agtatctatatcaagcacagttaatattgcatatcaaataggcagtatatgtactcgtccaagagattgtgagtcaggtttgccatctacagctcactgt |
10008139 |
T |
 |
| Q |
129 |
tttcattcttattttataactagtcaatgcaaatggtatgaaaacattacaaacataatgttttgcatgcaaaaaagaatgggcatgcatcttaataact |
228 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10008138 |
tttcattcttattttacaactagtcaatgcaaatggtatgaaaacattacaaacataatgttttgcatgcaaaaaagaatgggcatgcatcttaataact |
10008039 |
T |
 |
| Q |
229 |
gatgaacatctattctttaggtttatggaattattaagttgtatttttaacgtttgcctttcaagttaatgatcgtatttgtaactttggtttggaattt |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10008038 |
gatgaacatctattctttaggtttatggaattattaagttgtatttttaacgtttgcctttcaagttaatgatcgtatttgtaactttggtttggaattt |
10007939 |
T |
 |
| Q |
329 |
ccttatgcataaaaaagaagtgtatgaaaatctttattaaagcttgacctttg |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10007938 |
ccttatgcataaaaaagaagtgtatgaaaatctttattaaagcttggcctttg |
10007886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University