View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1300_low_14 (Length: 377)
Name: NF1300_low_14
Description: NF1300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1300_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 72 - 285
Target Start/End: Complemental strand, 13992023 - 13991810
Alignment:
| Q |
72 |
tatcataggaatatggattcaaaaggtatttttggttagtctatccgtcattattggaataatacaaaggatggcatttcttccttatacgaaaaattgg |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13992023 |
tatcataggaatatggattcaaaaggtatttttggttagtctatccgtcattattggaataatacaaaggatggcatttcttccttatacgaaaaattgg |
13991924 |
T |
 |
| Q |
172 |
ttatttgtatagcaaggaaaattcacagtcctgccaattgcattcaaaataaaacttgaggaaataaccaagcatcgaaaatgcttgattttgatctact |
271 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13991923 |
ttatttatatagcaaggaaaattcacagtcctgccaattgcattcaaaataaaacttgaggaaataaccaagcatcgaaaatgcttgactttgatctact |
13991824 |
T |
 |
| Q |
272 |
gtgacatttcttgt |
285 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
13991823 |
gtgacatttcttgt |
13991810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University