View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1300_low_17 (Length: 320)
Name: NF1300_low_17
Description: NF1300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1300_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 13992020 - 13991810
Alignment:
| Q |
18 |
cataggaatatggattcaaaaggtatttttggttagtctatccgtcattattggaataatacaaaggatggcatttcttccttatacgaaaaattggtta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13992020 |
cataggaatatggattcaaaaggtatttttggttagtctatccgtcattattggaataatacaaaggatggcatttcttccttatacgaaaaattggtta |
13991921 |
T |
 |
| Q |
118 |
tttgtatagcaaggaaaattcacagtcctgccaattgcattcaaaataaaacttgaggaaataaccaagcatcgaaaatgcttgattttgatctactgtg |
217 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13991920 |
tttatatagcaaggaaaattcacagtcctgccaattgcattcaaaataaaacttgaggaaataaccaagcatcgaaaatgcttgactttgatctactgtg |
13991821 |
T |
 |
| Q |
218 |
acatttcttgt |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
13991820 |
acatttcttgt |
13991810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University