View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1300_low_18 (Length: 320)
Name: NF1300_low_18
Description: NF1300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1300_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 7e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 85 - 238
Target Start/End: Original strand, 21566296 - 21566449
Alignment:
| Q |
85 |
cacagacacgacgacattctagtaatattataggcaatattaaatgttttgtagcaactgatagttgacactatcagattaaactattattaaatttatt |
184 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21566296 |
cacagacacgacgacatgctagtaatattataggcaatattaaatgttttgtagcaactgatagttgacactatcagattaaactattattaaatttatt |
21566395 |
T |
 |
| Q |
185 |
tttaagtaatgcaacaataaataaagccaataatcaactgatagtcacaggttc |
238 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21566396 |
tttaagtaatacaacaataaataaagccaataatcaactgatagtcacaggttc |
21566449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University