View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1300_low_28 (Length: 258)
Name: NF1300_low_28
Description: NF1300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1300_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 36 - 243
Target Start/End: Complemental strand, 37280365 - 37280158
Alignment:
| Q |
36 |
agtctgtaatattttcaggtatatatggattttaaatgttctattgctaggtgtttatgtaacattggttttttctagttgaacgaagacccttccttca |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37280365 |
agtctgtaatattttcaggtatatatggattttaaatgttctattgctaggtgtttatgtaacattggttttttctagttgaacgaagacccttccttca |
37280266 |
T |
 |
| Q |
136 |
aaccacagggtgggagactaggagaaagtgacatggattatgatacagatgaaaaatcaatggcatcactaagacgtcgtcttagaagagctcgtgagca |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37280265 |
aaccacagggtgggagactaggagaaagtgacatggattatgatacagatgaaaaatcaatggcatcactaagacgtcgtcttagaagagctcgtgagca |
37280166 |
T |
 |
| Q |
236 |
gtattatc |
243 |
Q |
| |
|
|||||||| |
|
|
| T |
37280165 |
gtattatc |
37280158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 39366386 - 39366264
Alignment:
| Q |
120 |
gaagacccttccttcaaaccacagggtgggagactaggagaaagtgacatggattatgatacagatgaaaaatcaatggcatcactaagacgtcgtctta |
219 |
Q |
| |
|
||||| || |||||||||||||| |||||| | |||| |||| ||| |||||||||||||||||||| || |||||||| |||||| |||| |||| |
|
|
| T |
39366386 |
gaagatccgtccttcaaaccacaaggtgggcaattaggggaaaatgatatggattatgatacagatgagaagtcaatggctaaactaaggcgtcatcttc |
39366287 |
T |
 |
| Q |
220 |
gaagagctcgtgagcagtattat |
242 |
Q |
| |
|
| | ||||||||| |||||||| |
|
|
| T |
39366286 |
ggaatgctcgtgaggagtattat |
39366264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University