View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1300_low_38 (Length: 246)

Name: NF1300_low_38
Description: NF1300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1300_low_38
NF1300_low_38
[»] chr4 (1 HSPs)
chr4 (9-246)||(30782472-30782710)


Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 9 - 246
Target Start/End: Complemental strand, 30782710 - 30782472
Alignment:
9 aggagcaaacgcagaaaacatgacccatccattgtatcagttatccagattcctagtgatcgcgtaaacggctgacatataagtaaacaccattgaaagt 108  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30782710 aggagcaaacgcagaaaacatgacccatccattgtatcagttatacagattcctagtgatcgcgtaaacggctgacatataagtaaacaccattgaaagt 30782611  T
109 gttgcaaaccatattgccaattggaaaggaagatttagatacataaacttttggattatttaatggaa-gtgtaatatgaatcgatctcaatggatgact 207  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
30782610 gttgcaaaccatatcgccaattggaaaggaagatttagatacataaacttttggattatttaatggaaggtgtaatatgaatcgatctcaatggatgact 30782511  T
208 tagatacattaatgtgtgtaattttgtgtttcttaaata 246  Q
    |||||||||||||||||||||||||||||||||||||||    
30782510 tagatacattaatgtgtgtaattttgtgtttcttaaata 30782472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University