View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1300_low_38 (Length: 246)
Name: NF1300_low_38
Description: NF1300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1300_low_38 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 9 - 246
Target Start/End: Complemental strand, 30782710 - 30782472
Alignment:
| Q |
9 |
aggagcaaacgcagaaaacatgacccatccattgtatcagttatccagattcctagtgatcgcgtaaacggctgacatataagtaaacaccattgaaagt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30782710 |
aggagcaaacgcagaaaacatgacccatccattgtatcagttatacagattcctagtgatcgcgtaaacggctgacatataagtaaacaccattgaaagt |
30782611 |
T |
 |
| Q |
109 |
gttgcaaaccatattgccaattggaaaggaagatttagatacataaacttttggattatttaatggaa-gtgtaatatgaatcgatctcaatggatgact |
207 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30782610 |
gttgcaaaccatatcgccaattggaaaggaagatttagatacataaacttttggattatttaatggaaggtgtaatatgaatcgatctcaatggatgact |
30782511 |
T |
 |
| Q |
208 |
tagatacattaatgtgtgtaattttgtgtttcttaaata |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30782510 |
tagatacattaatgtgtgtaattttgtgtttcttaaata |
30782472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University