View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1300_low_42 (Length: 226)

Name: NF1300_low_42
Description: NF1300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1300_low_42
NF1300_low_42
[»] chr7 (1 HSPs)
chr7 (140-226)||(36112269-36112355)


Alignment Details
Target: chr7 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 140 - 226
Target Start/End: Original strand, 36112269 - 36112355
Alignment:
140 caccacagacacgaattcccgggcaatcaattcatgcacagcacnnnnnnnnnnnncataagcaatttcatctttacacaaaacctt 226  Q
    ||||||| ||||||||||||||||||||||||||||||||||||            |||||||||||||||||||||||||||||||    
36112269 caccacaaacacgaattcccgggcaatcaattcatgcacagcacaaaaacaaaaaacataagcaatttcatctttacacaaaacctt 36112355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University