View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13010_low_10 (Length: 292)
Name: NF13010_low_10
Description: NF13010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13010_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 7e-49; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 172 - 274
Target Start/End: Complemental strand, 35037576 - 35037474
Alignment:
| Q |
172 |
taatatgaacaatctggttcacctggatgctgtggataagattcagaatctattgtttcacctacctcaatttaatcatctacagtgagcctgaaacaaa |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35037576 |
taatatgaacaatctggttcacctggatgctgtggataagattcagaatctattgtttcacctacctcaatttaatcatctacaatgagcctgaaacaaa |
35037477 |
T |
 |
| Q |
272 |
agc |
274 |
Q |
| |
|
||| |
|
|
| T |
35037476 |
agc |
35037474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 92 - 173
Target Start/End: Complemental strand, 35037719 - 35037638
Alignment:
| Q |
92 |
gcaactagaggaataaattatgtattaagtatcaacataactaataagaacaaaatatgtagaaatacattgtacgttacta |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35037719 |
gcaactagaggaataaattatgtattaagtatcaacataactaataagaacaaaatatgtaaaaatacattgtacgttacta |
35037638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 35037745 - 35037716
Alignment:
| Q |
1 |
agagatcattcatcccatttgaccctgcaa |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35037745 |
agagatcattcatcccatttgaccctgcaa |
35037716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University