View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13010_low_15 (Length: 234)
Name: NF13010_low_15
Description: NF13010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13010_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 216
Target Start/End: Original strand, 17083352 - 17083549
Alignment:
| Q |
19 |
aatatacaataggtttgcagggtcattgaaatttgataaacaatatagcatccaattgttttgaccttaacttgaatgtaagacaaagatttatagtgct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17083352 |
aatatacaataggtttgcagggtcattgaaatttgataaacaatatagcatccaattgttttgaccttaacttgaatgtaagacaaagatttatagtgct |
17083451 |
T |
 |
| Q |
119 |
tcctaaatgtttctttgctaggaatctaatatagatccaactgtggcagagtccaatttttaaacccagcaatttctgattctgagcatagataatga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17083452 |
tcctaaatgtttctttgctaggaatctaatatagatccaactgtggcagagtccaatttttaaacccagcaatttctgattctgagcatagataatga |
17083549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University