View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13010_low_16 (Length: 233)
Name: NF13010_low_16
Description: NF13010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13010_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 1e-55; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 16 - 157
Target Start/End: Complemental strand, 39525986 - 39525846
Alignment:
| Q |
16 |
atgaacgaacgagattgggccttgattgtgcaaccgtgggtttgatcggattggcagttctggtccacccccgactgaaaccgaccgtttatccacccct |
115 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
39525986 |
atgaacgaacgggattgg-ccttgattgtgcaaccgtgggtttgatcggattggcagttctggttcaccgtcgaccgaaaccgaccgtttatccacccct |
39525888 |
T |
 |
| Q |
116 |
aaaagaagggaacacaaagaaagggttggaaggaaccaactt |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39525887 |
aaaagaagggaacacaaagaaagggttggaaggaaccgactt |
39525846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 214
Target Start/End: Complemental strand, 39525811 - 39525751
Alignment:
| Q |
154 |
acttcagacgaatcatcacaaacatcgatcctccaaaactcccgtaaacaaccattctcct |
214 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39525811 |
acttcagacaaatcatcacaaacatcaatcctccaaaactcccgtaaacaaccattctcct |
39525751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 113
Target Start/End: Original strand, 41415537 - 41415604
Alignment:
| Q |
46 |
caaccgtgggtttgatcggattggcagttctggtccacccccgactgaaaccgaccgtttatccaccc |
113 |
Q |
| |
|
||||||||||||||| |||||||||| || ||||| | ||||| |||||||||||||| ||||||| |
|
|
| T |
41415537 |
caaccgtgggtttgaacggattggcattttcggtccgtcaccgaccgaaaccgaccgtttgtccaccc |
41415604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 118 - 152
Target Start/End: Complemental strand, 41215865 - 41215831
Alignment:
| Q |
118 |
aagaagggaacacaaagaaagggttggaaggaacc |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41215865 |
aagaagggaacacaaagaaagggttggaaggaacc |
41215831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 164 - 212
Target Start/End: Complemental strand, 41215762 - 41215713
Alignment:
| Q |
164 |
aatcatcacaaacatcga-tcctccaaaactcccgtaaacaaccattctc |
212 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||| ||||||||||| |
|
|
| T |
41215762 |
aatcatcacaaacatcaaatcctccaaaactcccgtaagcaaccattctc |
41215713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 46 - 116
Target Start/End: Complemental strand, 4475808 - 4475738
Alignment:
| Q |
46 |
caaccgtgggtttgatcggattggcagttctggtccacccccgactgaaaccgaccgtttatccaccccta |
116 |
Q |
| |
|
||||||||||||||| |||||||||| || ||||| | ||||| |||||||||||||| |||||||||| |
|
|
| T |
4475808 |
caaccgtgggtttgaacggattggcattttcggtccgtcgccgaccgaaaccgaccgtttgtccaccccta |
4475738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 116
Target Start/End: Original strand, 42740929 - 42740999
Alignment:
| Q |
46 |
caaccgtgggtttgatcggattggcagttctggtccacccccgactgaaaccgaccgtttatccaccccta |
116 |
Q |
| |
|
||||||||||||||| |||||||||| || ||||| ||||| |||||||||||||| |||||||||| |
|
|
| T |
42740929 |
caaccgtgggtttgaacggattggcattttcggtccgttgccgaccgaaaccgaccgtttgtccaccccta |
42740999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 46 - 116
Target Start/End: Original strand, 42970595 - 42970665
Alignment:
| Q |
46 |
caaccgtgggtttgatcggattggcagttctggtccacccccgactgaaaccgaccgtttatccaccccta |
116 |
Q |
| |
|
||||||||||||||| |||||||||| || ||||| | ||||| |||||||||||||| |||||||||| |
|
|
| T |
42970595 |
caaccgtgggtttgaacggattggcattttcggtccgtcgccgaccgaaaccgaccgtttgtccaccccta |
42970665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 117
Target Start/End: Original strand, 33694437 - 33694508
Alignment:
| Q |
46 |
caaccgtgggtttgatcggattggcagttctggtccacccccgactgaaaccgaccgtttatccacccctaa |
117 |
Q |
| |
|
||||||||||||||| |||||||||| || ||||| ||||| |||||||||||||| ||||||||||| |
|
|
| T |
33694437 |
caaccgtgggtttgaacggattggcattttcggtccgttgccgaccgaaaccgaccgtttgtccacccctaa |
33694508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University