View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13010_low_18 (Length: 203)
Name: NF13010_low_18
Description: NF13010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13010_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 81 - 185
Target Start/End: Complemental strand, 22982708 - 22982604
Alignment:
| Q |
81 |
ttgagcctatcagtaacaatgtggaaaacatgttaaaacatcttgcaaattcattatcgcataatcttcaagaaaaatagtagttcacctcattatcgcg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22982708 |
ttgagcctatcagtaacaatgtggaaaacatgttaaaacatcttgcaaattcattatcgcataatcttcaagaaaaatagaagttcacctcattatcgcg |
22982609 |
T |
 |
| Q |
181 |
tagaa |
185 |
Q |
| |
|
||||| |
|
|
| T |
22982608 |
tagaa |
22982604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 74 - 114
Target Start/End: Complemental strand, 38398022 - 38397982
Alignment:
| Q |
74 |
cgcaaaattgagcctatcagtaacaatgtggaaaacatgtt |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38398022 |
cgcataattgagcctatcagtaacaatgtggaaaacatgtt |
38397982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University