View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13010_low_6 (Length: 403)
Name: NF13010_low_6
Description: NF13010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13010_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 377; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 377; E-Value: 0
Query Start/End: Original strand, 1 - 381
Target Start/End: Complemental strand, 41146522 - 41146142
Alignment:
| Q |
1 |
gagttagtgaccagatggctttaaaaatcacttgggattttgaacttgaaaaaagctggagggatgaggatattatcttcgtcaagattctttatgccta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41146522 |
gagttagtgaccagatggctttaaaaatcacttgggattttgaacttgaaaaaagctggagggatgaggatattatcttcgtcaagattctttatgccta |
41146423 |
T |
 |
| Q |
101 |
gctacagctgtagattgagtttatgcatattatgagaattttgcaggctcatactgtgcgtgctcactgtcactggtattattattgggtttgcttcatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41146422 |
gctacagctgtagattgagtttatgcatattatgagaattttgcaggttcatactgtgcgtgctcactgtcactggtattattattgggtttgcttcatg |
41146323 |
T |
 |
| Q |
201 |
agcaagtggaaccgcaaaatttcttattgtggattatcatttgttatcatagctagttgttgcttcttggggcacgcatttcatacaatctacaacattg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41146322 |
agcaagtggaaccgcaaaatttcttattgtggattatcatttgttatcatagctagttgttgcttcttggggcacgcatttcatacaatctacaacattg |
41146223 |
T |
 |
| Q |
301 |
aattaagaatcaaggaagtaaggaaaaacattttttattaaaccaactacaggttgcaatgggaaggatgatcgatgtctt |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41146222 |
aattaagaatcaaggaagtaaggaaaaacattttttattaaaccaactacaggttgcaatgggaaggatgatcgatgtctt |
41146142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University