View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13010_low_9 (Length: 319)
Name: NF13010_low_9
Description: NF13010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13010_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 1 - 304
Target Start/End: Original strand, 5982665 - 5982968
Alignment:
| Q |
1 |
caccaatgccttggtaccaacctcaacatgctggatatgcaataccaccaccaatgtatccaggatcagggcctctacatggttacaatggatatagtca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982665 |
caccaatgccttggtaccaacctcaacatgctggatatgcaataccaccacaaatgtatccaggatcagggcctctacatggttacaatggatatagtca |
5982764 |
T |
 |
| Q |
101 |
tcccatgggaccacatggttacaatggatatggtcatctcatgggaccggattatggacattatggttcaaggatgccaatgtcaagacccaatcccatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982765 |
tcccatgggaccacatggttacaatggatatggtcatctcatgggaccggattatggacattatggttcaaggatgccaatgtcaagacccaatcccatg |
5982864 |
T |
 |
| Q |
201 |
atccactacaacagttatgctgacaattatcgctatactatgtagatgaagtatgtcaaagttgttggctacaagaacttactatggtttacttttcaga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982865 |
atccactacaacagttatgctgacaattatcgctatactatgtagatgaagtatgtcaaagttgttggctacaagaacttactatggtttacttttcaga |
5982964 |
T |
 |
| Q |
301 |
ctat |
304 |
Q |
| |
|
|||| |
|
|
| T |
5982965 |
ctat |
5982968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University