View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13011_high_4 (Length: 395)
Name: NF13011_high_4
Description: NF13011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13011_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 2e-65; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 37790169 - 37789942
Alignment:
| Q |
18 |
aactcagtcttcgacggagtaatgataagagatgtttcatgataaaacaactgtgaatatgaacaactgcaagggaatggtgacgacga-------caaa |
110 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||| |||| ||||||| |||||||||||||||||||||| |||| |
|
|
| T |
37790169 |
aactcagtcttcgaaggagcaatgataagagatgtttcatgataaaacaaccgtgacgatgaacag-tgcaagggaatggtgacgacgaacgacgacaaa |
37790071 |
T |
 |
| Q |
111 |
ggaaaggggacacggaccgttgccttttctttggggtttcagttcaatccacaaaaacgaggaagcaagttaacttaga---------agttgtcgtttg |
201 |
Q |
| |
|
|| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37790070 |
ggtaatgggacacggaccgttgccttttctttggggtttcagttcaatccacaaaaacgaggaagcaagttaacttagaaggcgaagcagttgtcgtttg |
37789971 |
T |
 |
| Q |
202 |
tggaagaagatgaaaacaagaggtaaaca |
230 |
Q |
| |
|
|||||||||| |||||||||||||||||| |
|
|
| T |
37789970 |
tggaagaagaagaaaacaagaggtaaaca |
37789942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 294 - 387
Target Start/End: Complemental strand, 37789878 - 37789785
Alignment:
| Q |
294 |
gcagctgcttcctatggcatatagaaatcccaatagtttattactgaagtctgcatgttgtggttccatatgcccattttggttctgatgatgt |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37789878 |
gcagctgcttcctatggcatatagaaatcccaatagtttattactgaagtctgcatgttgtagttccatatgcccattttggttctgatgatgt |
37789785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 294 - 383
Target Start/End: Complemental strand, 37800718 - 37800629
Alignment:
| Q |
294 |
gcagctgcttcctatggcatatagaaatcccaatagtttattactgaagtctgcatgttgtggttccatatgcccattttggttctgatg |
383 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
37800718 |
gcagctgcttcctatagcacatagaacgcccaatagtttattactaaagtctgcatgttgcggctccatatgcccattttggttctgatg |
37800629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University