View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13012_high_3 (Length: 301)
Name: NF13012_high_3
Description: NF13012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13012_high_3 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 76 - 301
Target Start/End: Complemental strand, 53659470 - 53659245
Alignment:
| Q |
76 |
taatctagatgagatttggggataaattgcagggtttaaggcacaacattccaaggcattgtcatccaaagttggtggaattgcttcagtggtgctggca |
175 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53659470 |
taatttagatgagatttggggataaattgcagggtttaaggcccaaaattccaaggcattgtcatccaaagttggtggaattgcttcagtggtgctggca |
53659371 |
T |
 |
| Q |
176 |
gcaagatccatctttgagacccagtttttcagaaattttggaatttttgatgcacatttccaagatggtatgtcaggccgttcctgatgaaatgatgaat |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53659370 |
gcaagatccatctttgagacccagtttttcagaaattttggaatttttgctgcacatttccaagatggtatgtcaggccgttcctgatgagatgatgaat |
53659271 |
T |
 |
| Q |
276 |
gacatttgaaaatcaataatttaaat |
301 |
Q |
| |
|
| ||||||||||| |||||||||||| |
|
|
| T |
53659270 |
gtcatttgaaaattaataatttaaat |
53659245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 53659578 - 53659499
Alignment:
| Q |
1 |
tacaaaaatatttgaatgaagtaaagtatatattggctatagtaaatgaagtaaattgaaaagtctatggtagcttaatc |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
53659578 |
tacaaaaatatttgaatgaagtaaagtatatattggctatagtaaatgaagtaaattgagaagtctatggtagctcaatc |
53659499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University