View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13015_low_7 (Length: 240)

Name: NF13015_low_7
Description: NF13015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13015_low_7
NF13015_low_7
[»] chr2 (1 HSPs)
chr2 (1-224)||(1239751-1239974)


Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 1239751 - 1239974
Alignment:
1 catgcttcatagattgtgatcaacgtactcgaaaacagtcaataaatagatagacaagggtggcaaaaagagctcgacaagtcaaattaccttttatgac 100  Q
    |||||||||||||||||||||||| |||||||||||| ||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||    
1239751 catgcttcatagattgtgatcaacatactcgaaaacaatcaataagtagatagacaagggtggcaaaaagagctcgaccagtcaaattaccttttatgac 1239850  T
101 ccgttatttttgacaggttatgctaaggttttgagttcatccctttagttggtatgtccagtttaacatgctgaaaaagcgaagtagggcaggctggttt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||    
1239851 ccgttatttttgacaggttatgctaaggttttgagttcatccctttagttggtatgtccggtttaacatgctgaaaaagcgaagtagggcaggctggctt 1239950  T
201 gcaaactcttcaagtatgggtagt 224  Q
    ||||||||||||||||||||||||    
1239951 gcaaactcttcaagtatgggtagt 1239974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University