View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13016_low_11 (Length: 244)
Name: NF13016_low_11
Description: NF13016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13016_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 25 - 168
Target Start/End: Original strand, 23047654 - 23047796
Alignment:
| Q |
25 |
ccttggagtttcgttttgcctcctcggtattgctcaacctgtttcggattatctgcaatcactttgtccaccattttttcaatttcaacaggatctgcta |
124 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| || |
|
|
| T |
23047654 |
ccttggagtttagttttgcctcctcggtattgctcgacctgtttcggattatctgcgatcgctttgtccaccattttttcaatttcaacaggatctgtta |
23047753 |
T |
 |
| Q |
125 |
tctgtcatttcaaaataataatcaatgaagttgttcagagtgga |
168 |
Q |
| |
|
|||||||||| |||||||||||||| |||||| |||||||||| |
|
|
| T |
23047754 |
tctgtcatttacaaataataatcaataaagttg-tcagagtgga |
23047796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University