View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13016_low_9 (Length: 277)
Name: NF13016_low_9
Description: NF13016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13016_low_9 |
 | |
|
| [»] scaffold0170 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0170 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 119 - 259
Target Start/End: Original strand, 7399 - 7539
Alignment:
| Q |
119 |
tactaacttgagcatcggagaacctacaggtacaccaccctcgtcgttccaaacattcaattagcatcaagcttgccacaccatacgtcgttcttctgat |
218 |
Q |
| |
|
|||| |||||||| ||| |||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
7399 |
tactgacttgagcgtcgaagaacctacaggtacaccaccctcatcgttaaaaacattcaattagcatcaagcttaccacaccagacgtcgttcttctgat |
7498 |
T |
|
| Q |
219 |
cgaatcagatcattcataatatttaaagagtgtcccaaatc |
259 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7499 |
cgaatcagatcattcataacatttaaagagtgtcccaaatc |
7539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0170; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 7220 - 7341
Alignment:
| Q |
1 |
aaacagagaaaagtggtgaaagtttggggtatgacacaaccgaattaagtcgaaccgcatgcttttttatctcacggttaaaatgacttttttctcaaaa |
100 |
Q |
| |
|
||||||||||||||||| ||| ||| |||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7220 |
aaacagagaaaagtggtcaaaatttagggtatgacacaaccgaactaagtcgaaccgcatgcttttgtatctcacggttaaaatgacttttttctcaaaa |
7319 |
T |
|
| Q |
101 |
ccgcaccgcgaacatccctact |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7320 |
ccgcaccgcgaacatccctact |
7341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 53 - 103
Target Start/End: Original strand, 24361556 - 24361606
Alignment:
| Q |
53 |
aaccgcatgcttttttatctcacggttaaaatgacttttttctcaaaaccg |
103 |
Q |
| |
|
|||| |||| ||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
24361556 |
aaccacatgtttttttatctcacggtttagatgacttttttctcaaaaccg |
24361606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 53 - 103
Target Start/End: Complemental strand, 42544679 - 42544628
Alignment:
| Q |
53 |
aaccgcatgcttttttatctcacggttaaaatgactttttt-ctcaaaaccg |
103 |
Q |
| |
|
||||||||||||||||||||| ||||| | ||||||||||| |||||||||| |
|
|
| T |
42544679 |
aaccgcatgcttttttatctcgcggtttagatgacttttttgctcaaaaccg |
42544628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 103
Target Start/End: Complemental strand, 9160999 - 9160950
Alignment:
| Q |
53 |
aaccgcatgcttttttatctcacggttaaaatgacttttttctcaaaaccg |
103 |
Q |
| |
|
||||||||||||||| ||||| ||||| |||||||||||||||||||||| |
|
|
| T |
9160999 |
aaccgcatgcttttt-atctcgcggtttgaatgacttttttctcaaaaccg |
9160950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 37 - 90
Target Start/End: Complemental strand, 41325132 - 41325079
Alignment:
| Q |
37 |
caaccgaattaagtcgaaccgcatgcttttttatctcacggttaaaatgacttt |
90 |
Q |
| |
|
|||||||||||| || |||||||| ||| |||||||| ||||| |||||||||| |
|
|
| T |
41325132 |
caaccgaattaaatcaaaccgcatacttatttatctcgcggttcaaatgacttt |
41325079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 53 - 93
Target Start/End: Complemental strand, 29389053 - 29389013
Alignment:
| Q |
53 |
aaccgcatgcttttttatctcacggttaaaatgactttttt |
93 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29389053 |
aaccgcatgcttttttatctcacggtttggatgactttttt |
29389013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University