View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13017_high_7 (Length: 374)
Name: NF13017_high_7
Description: NF13017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13017_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 9 - 358
Target Start/End: Original strand, 14420863 - 14421214
Alignment:
| Q |
9 |
gaagaaaatgaagtctaacaaatccaaagagttctatgcagaactcaaagccttatgcaaaatccatcatatcaatattgtatgttataattatctttga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14420863 |
gaagaaaatgaagtctaacaaatccaaagagttctatgcagaactcaaagccttatgcaaaatccatcatatcaatattgtatgttataattatctttga |
14420962 |
T |
 |
| Q |
109 |
catattggatttcctgcatttagcaatatcatgcattaacgcagcagtcaatacattggtggttgttggatcaaagatcagacggttcgaatttcaaact |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14420963 |
catattggatttcctgcatttagcaatatcatgcattaacgcagcagtcaatacattggtggttgttggatcaaagatcagacggtccgaatttcaaact |
14421062 |
T |
 |
| Q |
209 |
catttttagatttttaaggaaaaatcaaaatatacattaaaatttagggcgtataatcttgattcaatagtcaccgataagttgactgcgtgaa--tgtg |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
14421063 |
catttttagatttttaaggaaaaatcaaaatctacattaaaatttagggcgtataatcttgattcaatagtcaccgataagctgactgcgtgaatgtgtg |
14421162 |
T |
 |
| Q |
307 |
tgatattgttgacatcacacaatccaattcatctaatatttcattattttat |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14421163 |
tgatattgttgacatcacacaatccaattcatctaatatttcattattttat |
14421214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University