View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13017_low_9 (Length: 365)
Name: NF13017_low_9
Description: NF13017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13017_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 1 - 306
Target Start/End: Complemental strand, 4378804 - 4378484
Alignment:
| Q |
1 |
ttagcctaggatgaggaactggtgagggagtgtaat---ctgttaatacctattgtcttacatgttggtactatagataggtggatatgccaattacata |
97 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4378804 |
ttagcttaggatgaggatctggtgagggagtgtaatgaactgttaatacctattgtcttacatgttggtactatagataggtgggtatgccaattacatc |
4378705 |
T |
 |
| Q |
98 |
tgtcaaaatcatttagcgt------------ccacttgtcgcattcttagcattcaagcggttcctcttaaggttaacctatttgattagcttctgcttc |
185 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4378704 |
tgtcaaaatcatttagcgtaagcaacgattaccacttgtcgcattcttagcattcaagcggttcctcttaaggttaatctatttgattagcttctgcttc |
4378605 |
T |
 |
| Q |
186 |
tcaatcgtatttcaactaaagataatttgtttacgcggaggatgctttatgataacgataaggtttgcatgggaggttgtggattgaatgaagatgtgga |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4378604 |
tcaatcgtatttcaactaaagataatttgtttatgcggaggatgcgttatgataacgataaggtttgcatgggaggttgtggattgaatgaagatgtgga |
4378505 |
T |
 |
| Q |
286 |
ccacttatttgtcaggtgtga |
306 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4378504 |
ccacttatttgtcaggtgtga |
4378484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University