View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13019_high_3 (Length: 266)
Name: NF13019_high_3
Description: NF13019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13019_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 24 - 259
Target Start/End: Original strand, 2777785 - 2778020
Alignment:
| Q |
24 |
ccatccccattttgggtccgtcctctccctcagtcttcttcaccaacgaccatggcatcccccgccaaactggataaagatcaggttttctctattctca |
123 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2777785 |
ccatccccattttgggtccttcctctccctcagtcttcttcaccaacgaccatggcatcccccgccaaactggataaagatcaggttttctctattctca |
2777884 |
T |
 |
| Q |
124 |
attttgcgttattaattacacttcaattctcttttatcttcttaatctcaatcaatatcactttcactcctcctccgagtatttttcaattcaaatcgtt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2777885 |
attttgcgttattaattacacttcaattctcttttatcttcttaatctcaatcgatatcactttcactcctcctccgagtatttttcaattcaaatcgtt |
2777984 |
T |
 |
| Q |
224 |
ttcttaccttcaaactgattctaactattttcttcg |
259 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
2777985 |
ttcttaccttcaaactgattctaactacttttttcg |
2778020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University