View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13019_low_2 (Length: 280)
Name: NF13019_low_2
Description: NF13019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13019_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 43147022 - 43147104
Alignment:
| Q |
1 |
attataaaacaaatatagaaaagacgtataaaattacatagaagtcaactttactctgaactgtgttaccaaatttttgtgtt |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43147022 |
attataaaacaaatatagaaaagacgtataaaattatatagaagtcaactttactctgaactgtgttaccaaatttttgtgtt |
43147104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 263
Target Start/End: Original strand, 43147245 - 43147284
Alignment:
| Q |
224 |
agttgagtgcattatgggagtgtttggcccagcttattgc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43147245 |
agttgagtgcattatgggagtgtttggcccagcttattgc |
43147284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 266
Target Start/End: Original strand, 39362723 - 39362765
Alignment:
| Q |
224 |
agttgagtgcattatgggagtgtttggcccagcttattgctga |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39362723 |
agttgagtgcattatgggagtgtttggcccagcttattgctga |
39362765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 49
Target Start/End: Original strand, 39362589 - 39362631
Alignment:
| Q |
7 |
aaacaaatatagaaaagacgtataaaattacatagaagtcaac |
49 |
Q |
| |
|
||||||||||||||||||||| ||||| || |||||||||||| |
|
|
| T |
39362589 |
aaacaaatatagaaaagacgtgtaaaactaaatagaagtcaac |
39362631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University