View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13019_low_4 (Length: 249)
Name: NF13019_low_4
Description: NF13019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13019_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 61 - 219
Target Start/End: Complemental strand, 3808921 - 3808763
Alignment:
| Q |
61 |
tcgacctctacatgagtaaatggcaagttatgttaagcttatcgcataattgatgtccaagaggatgacccttcgagtgttgctcaaaatctttgttaac |
160 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3808921 |
tcgacctctgcatgagtaaatggcaagttccgttaagcttatcgcataattgatgtccaagcggatgaccctttgagtgttgctcaaaatctttgttaac |
3808822 |
T |
 |
| Q |
161 |
nnnnnnncataattacaagctgcataaataaatatatagaaacttgcctaagttaagcc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3808821 |
aaaaaaacataattacaagctgcataaataaatatatagaaacttgcctaagttaagcc |
3808763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University