View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1301_low_10 (Length: 359)
Name: NF1301_low_10
Description: NF1301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1301_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 12 - 241
Target Start/End: Original strand, 2597231 - 2597457
Alignment:
| Q |
12 |
ttaaaagaaagatagagaagatcaaaaagtaaaaagagcataatcaattagtaaataattagaggagaaatgtaaattgaattgataacttatttttcaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2597231 |
ttaaaagaaagatagagaagatcaaaaagtaaaaagagcataatcaattagtaaataattagaggagaaatgtaaattgaattgataacttatttttcaa |
2597330 |
T |
|
| Q |
112 |
ttattatatgtctctcttatgttaaatctttttatttctcataatcaattagttattcctctttgctatttctcacaaaggaatgtttcaaacacttttt |
211 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2597331 |
tta---tatgtctctcttatgttaaatctttttatttctcataatcaattagttattcctctttgctatttctcacaaaggaatgtttcaaacacttttt |
2597427 |
T |
|
| Q |
212 |
taacattgatccaaacatagtagttgtgtt |
241 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
2597428 |
taacattgatccaaacatagtagttctgtt |
2597457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University