View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1301_low_15 (Length: 256)
Name: NF1301_low_15
Description: NF1301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1301_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 14490178 - 14489963
Alignment:
| Q |
1 |
aaattttcaaacttcaaatgactatccattcatagtttctattaattacagttctgcatatgtgcttgtattgatccgtctggttgcatgatttttactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14490178 |
aaattttcaaacttcaaatgactatccattcatagtttctattaattacagttctgcatatgtgcttgtattgatccgtctggttgcatgatttttactt |
14490079 |
T |
 |
| Q |
101 |
aattatctaataaactttacaaaaaagtgatgacttcattccatgagtcgttcatagcttttagtgacaaatagtttcgcagaaaaaatctagcatgtcc |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14490078 |
aattatctaataaaatttacaaaaaagtgatgacttcattccatgagtcgttcatagcttttagtgacaaatagtttcgcagaaaaaatctagcatgtcc |
14489979 |
T |
 |
| Q |
201 |
tctatgtatactttca |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
14489978 |
tctatgtatactttca |
14489963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University