View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1301_low_7 (Length: 405)
Name: NF1301_low_7
Description: NF1301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1301_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 28 - 395
Target Start/End: Original strand, 25709031 - 25709398
Alignment:
| Q |
28 |
aaaaatatcgtgaagaaaaaacacgacgaatttttattcaatggaaactattggagcccaatcatgctatcatgacggatccgattccatcgggaaagtt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
25709031 |
aaaaatatcgtgaagaaaaaacacgacgaatttttattcaatggaaactattggagcccaatcatgctatcatgacggatccgattccatcgggaaagat |
25709130 |
T |
|
| Q |
128 |
caaggacattcgtgaaattgcaaagttgatggttggtgcaagagttgaagaggagttcaccaacaagtacatcagtaaccgcaggggatttttgcaagaa |
227 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25709131 |
caacgacattcgtgaaattgcaaagttgatggttggtgcaagagttgaagaggagttcaccaacaagtacatcagtaaccgcaggggatttttgcaagaa |
25709230 |
T |
|
| Q |
228 |
ctcctaattaataaattgttgggtttgcaagatatcaacatcgatgactacaatgtgaaatatgcagagacgatggctaagaattggagcattgcttttg |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25709231 |
ctcctaattaataaattgttgggtttgcaagatatcaacatcgatgacgacaatgtgaaatatgcagagacgatggctaagaattggagcattgcttttg |
25709330 |
T |
|
| Q |
328 |
atgccgctctctgtatattatttcccactgaacaaagactttgtgaccttgtcttttccggtatctct |
395 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25709331 |
atgccgctctctgtatattatttccaattgaacaaagactttgtgaccttgtcttttccggtatctct |
25709398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University