View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1301_low_8 (Length: 396)

Name: NF1301_low_8
Description: NF1301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1301_low_8
NF1301_low_8
[»] chr2 (2 HSPs)
chr2 (264-396)||(36054608-36054739)
chr2 (100-170)||(36054807-36054877)


Alignment Details
Target: chr2 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 264 - 396
Target Start/End: Complemental strand, 36054739 - 36054608
Alignment:
Q  264 ttttaggtactgtttgtgacatgatcatatgttgctttaatttcttcaccnnnnnnncatgtagctttaattttgtaccctggtttggtgattgtgaaga 363  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||| || |||||||||||||||||    
T  36054739 ttttaggtactgtttgtgacatgatcatatgttgctttaatttcttcaccaaaaaaacatgtagctttaattttgtaccttg-tttggtgattgtgaaga 36054641  T
Q  364 atcataaattaggagaaagaaagtgttctggcc 396  Q
    |||||||||||||||||||||||||||||||||    
T  36054640 atcataaattaggagaaagaaagtgttctggcc 36054608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 100 - 170
Target Start/End: Complemental strand, 36054877 - 36054807
Alignment:
Q  100 tactaatatttaggcagaaactaggtagtgtgttttttaatctgttatgccagttaataatactatgattt 170  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36054877 tactaatatttaggcagaaactaggtagtgtgttttttaatctgttatgccagttaataatactatgattt 36054807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University