View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1302-Insertion-3 (Length: 129)
Name: NF1302-Insertion-3
Description: NF1302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1302-Insertion-3 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 17 - 129
Target Start/End: Complemental strand, 35033065 - 35032953
Alignment:
| Q |
17 |
tttgttagtcaaacaaatcctggacccaagattttctagttagtttatttcttttgaaaccattttgataatccacgattttggttaccatatatttaat |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35033065 |
tttgttagtcaaacaaatcccggacccaagattttctagttagtttatttcttttgaaaccattttgataatccacgattttggttaccatatatttaat |
35032966 |
T |
 |
| Q |
117 |
tcatgattccatg |
129 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35032965 |
tcatgattccatg |
35032953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University