View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1302-Insertion-4 (Length: 406)
Name: NF1302-Insertion-4
Description: NF1302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1302-Insertion-4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 8e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 8 - 173
Target Start/End: Complemental strand, 34389169 - 34389004
Alignment:
| Q |
8 |
agatttacctaagtgtaagatttcattgtttgaaatcttttattttgcctaacaaaaattcattttgtttgaaatataaatcaatttcacaattgagtgc |
107 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34389169 |
agatttagctaagtgtaagatttcatagtttgaaatcttttattttgcctaacaaaaattcattttgtttgaaatataaatcaatttcacaattgagtgc |
34389070 |
T |
|
| Q |
108 |
gtcataccgaggattttgttttttggcgaaatattgaggagttaccggtgtagcaatatgttggtc |
173 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34389069 |
gtcataccgaggattttgttttttgacggaatattgaggagttaccggtgtagcaatattttggtc |
34389004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 247 - 405
Target Start/End: Complemental strand, 34388930 - 34388768
Alignment:
| Q |
247 |
caaccaaattagttttcttgcttatttgttttctctctattccagctggctaggtta----gcccttgtgtnnnnnnnngttgttatcctaatatcagac |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
34388930 |
caaccaaattagttttcttgcttatttgttttctctctattccagctggctaggttaattagcccttgtgtaaaaaaaagttgttatactaatatcagac |
34388831 |
T |
|
| Q |
343 |
aaacccaaaaatagaaagaacagagttccatgccaacttcacttgtgatgattacaacgattc |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34388830 |
aaacccaaaaatagaaagaacagagttccatgccaacttcacttgtgatgattgcaacgattc |
34388768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University