View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13020_high_26 (Length: 254)
Name: NF13020_high_26
Description: NF13020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13020_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 20 - 233
Target Start/End: Original strand, 7755331 - 7755544
Alignment:
| Q |
20 |
atattgagttgaagagtttaagatattagtttgttttgatcccattctgtaccagctaccagtgttaagaaatggtttcttaaggttgtttccatcttca |
119 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7755331 |
atattgagttgaagaatttaagatattagtttgttttgatcccattctgtaccagctaccagtgttaagaaatggtttcttaaggttgtttccatcttca |
7755430 |
T |
 |
| Q |
120 |
taatcttctctgatcaagctcattgcagcttcagaaacaaaacttcaaagttcaacaagagaggtaggtgtctctatcccttgttacttgtgatgtttgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7755431 |
taatcttctctgatcaagctcattgcagcttcagaaacaaaacttcaaagttcaacaagagaggtaggtgtctctatcccttgttacttgtgatgtttgt |
7755530 |
T |
 |
| Q |
220 |
tgagacaaaagaca |
233 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7755531 |
tgagacaaaagaca |
7755544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University