View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13020_high_28 (Length: 246)
Name: NF13020_high_28
Description: NF13020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13020_high_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 20 - 239
Target Start/End: Complemental strand, 35808696 - 35808477
Alignment:
| Q |
20 |
gcataggtgctatagcacttttgcaaaggaagatggttgaacttcaacatgatcttgccattgcaaaggatcgtctggctcgttgcgctgcggctgctgc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35808696 |
gcataggtgctatagcacttttgcaaaggaagatggttgaacttcaacatgatcttgccattgcaaaggatcgcctggctcgttgcgctgcggctgctgc |
35808597 |
T |
|
| Q |
120 |
tactcctacttcttctttttccaatgatatgatgaattcaaatgttagtttgccaccttttcctgagtttttcacttgcagtgacttcagtgataattta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35808596 |
tactcctacttcttctttttccaatgatatgatgaattcaaatgttagtttgccaccttttcctgagtttttcacttgcagtgacttcagtgataattta |
35808497 |
T |
|
| Q |
220 |
agtcacagttcttcatctca |
239 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
35808496 |
agtcacagttcttcgtctca |
35808477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 40 - 104
Target Start/End: Complemental strand, 32036309 - 32036245
Alignment:
| Q |
40 |
ttgcaaaggaagatggttgaacttcaacatgatcttgccattgcaaaggatcgtctggctcgttg |
104 |
Q |
| |
|
||||||||||||||| | |||||||| |||||| | |||||||| ||||| ||||| |||||||| |
|
|
| T |
32036309 |
ttgcaaaggaagatgatggaacttcagcatgatttggccattgctaaggaacgtcttgctcgttg |
32036245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University