View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13020_high_31 (Length: 216)
Name: NF13020_high_31
Description: NF13020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13020_high_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 40 - 209
Target Start/End: Complemental strand, 14987799 - 14987630
Alignment:
| Q |
40 |
cttaggtattttgtaagtaatatttttgtatatttggtgaggaggtttgagtttcacaatcaaaatgtgacgtaaagagagggaaaagataggtaaaatg |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14987799 |
cttaggtattttgtaagtaatatttttgtatatttggtgaggaggtttgagtttcacaatcaaaatgtgacgtaaagagagggaaaagataggtaaaatg |
14987700 |
T |
|
| Q |
140 |
gaagaggaggatggttgaaggagtcatgggatctactacacacatatagaaacatacattgctgatgatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14987699 |
gaagaggaggatggttgaaggagtcatgggatctactacacacatatagaaacatacattgctgatgatg |
14987630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University