View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13020_low_12 (Length: 433)
Name: NF13020_low_12
Description: NF13020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13020_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 2e-53; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 107 - 278
Target Start/End: Original strand, 16081447 - 16081634
Alignment:
| Q |
107 |
gtgatgtttagcatcattgcctagtttatatgttaaacgaaatacgaccaactatgtctctatttatatattggattgactgtgagtttggcaaaattat |
206 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
16081447 |
gtgatgtttagcatcactgcctagcttatatgttaaacgaaatacaaccaattatgtctctatttatatattggattgaccgtgagtttgacaaaattat |
16081546 |
T |
 |
| Q |
207 |
agtgag----------------actcctaaatcctaagtataatttagccaaaatcacattaacgcactataaatctgtcaaactcat |
278 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16081547 |
ggtgagagtgtgattttgtcaaactcctaaatcctaagtataatttagccaaaatcacattaacgcactataaatctgtcaaactcat |
16081634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 65 - 121
Target Start/End: Original strand, 45368919 - 45368976
Alignment:
| Q |
65 |
cattataattagctctc-cgatgcattcactacaatttctatcgtgatgtttagcatc |
121 |
Q |
| |
|
||||||||||||||| | |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45368919 |
cattataattagctcacgcgatgcattcgctacaatttctatcgtgatgtttagcatc |
45368976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University