View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13020_low_25 (Length: 255)
Name: NF13020_low_25
Description: NF13020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13020_low_25 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 9 - 255
Target Start/End: Complemental strand, 27349870 - 27349624
Alignment:
| Q |
9 |
gaagaatatgaagtgagtaaacttttatgattactaacatgtactgatttttatgaaattctttatttggtgacaatattatatctttgaggactaattc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27349870 |
gaagaatatgaagtgagtaaacttttatgattactaaaatgtactgatttttatgaaattctttatttggtgacaatattatatctttgaggactaattc |
27349771 |
T |
|
| Q |
109 |
atcaaaataaactttagaggaataatatggtgacatttcaaattttaagcactaatttagtggcaaaaatcaatgaatgtttaatgtgacaatgctgtaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27349770 |
atcaaaataaactttagaggaataatatggtgacatttcaaattttaagcactaatttagtggcaaaaatcaatgaatgttgaatgtgacaatgctgtaa |
27349671 |
T |
|
| Q |
209 |
tcattggaggaccacattgaatgtttgctcaaaatctatggaggaac |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27349670 |
tcattggaggaccacattgaatgtttgctcaaaatctatggaggaac |
27349624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University