View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13020_low_27 (Length: 254)
Name: NF13020_low_27
Description: NF13020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13020_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 13 - 239
Target Start/End: Original strand, 34927660 - 34927886
Alignment:
| Q |
13 |
taggcgtaaatatcaatagaactcggggcagggagacatgaatatcatgctaaacagaaaacttgaagatggtgtagttatttgttgagcacacgcatca |
112 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34927660 |
taggcgtaaatatcaatagaactcagagcagggagacatgaatatcatgctaaacagaaaacttgaagatggtgtagttatttgttgagcacacacatca |
34927759 |
T |
|
| Q |
113 |
ggctcaagatgaagaaaatgaataaatgaatccagaaaaaagaatttacatttcaaagaatttatcaagaacttttgcatatattgtaatggatgacaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34927760 |
ggctcaagatgaagaaaatgaataaatgaatccagaaaaaagaatttacatttcaaagaatttatcaagaacttttgcatatattgtaatggatgacaaa |
34927859 |
T |
|
| Q |
213 |
taaactagttagtgattgaacaaaaat |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
34927860 |
taaactagttagtgattgaacaaaaat |
34927886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University