View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13020_low_8 (Length: 482)
Name: NF13020_low_8
Description: NF13020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13020_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 299; Significance: 1e-168; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 150 - 464
Target Start/End: Original strand, 48397464 - 48397778
Alignment:
| Q |
150 |
tgatataatgcacctcgttaattaactcttaccagatctaatcatgctacggaggacaatgtgcaagaagccataaggcttttcaccgtgtctacaatgg |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48397464 |
tgatataatgcacctcgttaattaactcttaccagatctaatcatgctacggaggacaatgtgcaagaagccataaggcttttcaccgtgtctacaatgg |
48397563 |
T |
|
| Q |
250 |
atgcagctaagtcgggaataaaccaacagataaatctctcacctgaaatggcccgtgagatacaggtttgtcgtgtgatgagctcatttctcttttttcc |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
48397564 |
atgcagctaagtcgggaataaaccaacagataaatctctcacctgaaatggcccgtgagatacaggtttgtcgtgtgatgcgttcatttctcttttttcc |
48397663 |
T |
|
| Q |
350 |
atatagttttcatatgctgattagttgtttgtttgctctgagcagcaagcagaagttcagataaaaagaagaatcgggattgggaaccacatatcagaaa |
449 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48397664 |
atataggtttcatatgctgattagttgtttgtttgctctgagcagcaagcagaagttcagataaagagaagaatcgggattgggaaccacatatcagaaa |
48397763 |
T |
|
| Q |
450 |
gaagactgattgatg |
464 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
48397764 |
gaagactgattgatg |
48397778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 7 - 88
Target Start/End: Original strand, 48397321 - 48397402
Alignment:
| Q |
7 |
tacataattctaccattgcatgtaaaatccttaatatgcattgcttaacgaaaatcactaaattctattacattaatcatcg |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48397321 |
tacataattctaccattgcatgtaaaatccttaatatgcattgcttaacgaaaatcactaaattctattacattaatcatcg |
48397402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University