View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13021_high_16 (Length: 271)
Name: NF13021_high_16
Description: NF13021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13021_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 18 - 144
Target Start/End: Complemental strand, 15454854 - 15454728
Alignment:
| Q |
18 |
ttaatggatctttaacagatagtccaccagtttcaccttctgaaatggatgatttcaaggtacatacatctttcttaatttcataggtggctttaatttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15454854 |
ttaatggatctttaacagatagtccaccagtttcaccttctgaaatggatgatttcaaggtacatacatctttcttaatttcataggtggctttaatttg |
15454755 |
T |
|
| Q |
118 |
acattaaaaaccttaacaaacaaccat |
144 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
15454754 |
acattaaaaaccttaacaaacaaccat |
15454728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 185 - 261
Target Start/End: Complemental strand, 15454687 - 15454611
Alignment:
| Q |
185 |
ggtacaaagcacgaaacactgatctcactgtacagtgtacagttagaaaccactagtaccaatttcagctttctctg |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15454687 |
ggtacaaagcacgaaacactgatctcactgtacagtgtacagttagaaaccactagtaccaatttcagctttctctg |
15454611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University