View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13021_high_17 (Length: 255)
Name: NF13021_high_17
Description: NF13021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13021_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 8271872 - 8272005
Alignment:
| Q |
1 |
aaagctgtcttaaaggcctgaattgtgacgatggaacatacaaacgtaaatattccactattacaacaagaatggactccatagttgaaaattgattgtg |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8271872 |
aaagctttcttaaaggcctgaattgtgacgatggaacatacaaatgtaaacattccactattacaacaagaatggactccattgttgaaaattgattgtg |
8271971 |
T |
 |
| Q |
101 |
ccctagtaaagccactgcaaatttatcattgttg |
134 |
Q |
| |
|
| |||| ||||||||||||||||||||||||||| |
|
|
| T |
8271972 |
ctctagcaaagccactgcaaatttatcattgttg |
8272005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 182 - 240
Target Start/End: Original strand, 8272423 - 8272481
Alignment:
| Q |
182 |
caaaatcatcgtgatattgtagaagcacaagttgtagctttgcatttgtcgcacctttg |
240 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8272423 |
caaaatcaccgtgatattgtagaagcacaagttgtagctttgcatttgtcgcacctttg |
8272481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University