View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13021_low_11 (Length: 382)
Name: NF13021_low_11
Description: NF13021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13021_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 36 - 364
Target Start/End: Original strand, 9828052 - 9828380
Alignment:
| Q |
36 |
ggtagataatactcatagtagatcggatttttaaattattttcgttttagggtaaaatgagagtgatggaagatcggttgcttaggaataaagaacacaa |
135 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9828052 |
ggtaaataatactcatagtaggtcggatttttaa-ttattttcgttttagggtaaaatgagagtgatggtagatcggttgcttaggaataaagaacacaa |
9828150 |
T |
|
| Q |
136 |
tcgggtgccatcttctcaagaacaaggtgcatatgacttatttgttaatctattgatgttagaagacgagaaacgatgtgatattactaaaataccatca |
235 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9828151 |
tcgggtgtcatcttctcaagaacacggtgcatatgacttatttgttaatctattgatgttagaagacgagaaacgatgtgatattactaaaatcccatca |
9828250 |
T |
|
| Q |
236 |
ggggatgggtgcatggaggggaaactcgatccctaccagagatggggatggagatcaaaattcctaccc-accggagtacatgttcgggatttttgtggg |
334 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||| ||||||||| ||||||||||| |||| |||||||||||||||||| ||| |||| | |
|
|
| T |
9828251 |
ggggatgggtgcatggtggggaaactcgatccctataagagacggggatggatatcaaaattccaaccctgccggagtacatgttcgggttttctgtgcg |
9828350 |
T |
|
| Q |
335 |
gaataatcggtgtttgggggtgagagaggt |
364 |
Q |
| |
|
| ||| |||| | ||||||||||||||||| |
|
|
| T |
9828351 |
ggatactcgggggttgggggtgagagaggt |
9828380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University