View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13021_low_15 (Length: 295)
Name: NF13021_low_15
Description: NF13021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13021_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 163 - 294
Target Start/End: Complemental strand, 41210304 - 41210173
Alignment:
| Q |
163 |
atttattaactatttaaatttaatcacttgatttatacattaatttttattatcagtcaacaaaacccaattttttatgtcttagaaagttactggcgac |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41210304 |
atttattaactatttaaatttaatcacttgatttatacattaatttttattatcagtcaacaaaacccaattttttatgtcttagaaagttactggcaac |
41210205 |
T |
|
| Q |
263 |
aaatactctgcattttgcctttgctactccac |
294 |
Q |
| |
|
||||||||| |||||||||||| |||||||| |
|
|
| T |
41210204 |
aaatactctacattttgcctttattactccac |
41210173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 20 - 161
Target Start/End: Complemental strand, 41210506 - 41210366
Alignment:
| Q |
20 |
gtatgtgatatgataaattttgtaattaaataaaataattacattgatnnnnnnnnnttgtcttaaccctcgagatttcataagaagcgtgtctgtaaat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41210506 |
gtatgtgatatgataaattttgtaattaaataaaataattacattgataaaaaaaa-ttgtcttaaccctcgagatttcataagaagcatgtctgtaaat |
41210408 |
T |
|
| Q |
120 |
tcaaaatttgataggctaaaacgtgtatatagtctcatcaat |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41210407 |
tcaaaatttgataggctaaaacgtgtatatagtctcatcaat |
41210366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University