View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13021_low_23 (Length: 238)
Name: NF13021_low_23
Description: NF13021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13021_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 27669579 - 27669799
Alignment:
| Q |
1 |
tctcaatcaattggattatacgcatgcaaatataaaatgatgtaacttaaaaatctcaacattaaatagagtagctataagaaaacgatatatatttgat |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27669579 |
tctcaatcaattggattatacgcctgcaaatataaaatgatgtaacttagaaatctcaacattaaatagagtagctataagaaaacgatatatatttgat |
27669678 |
T |
|
| Q |
101 |
ttcaatcaccagaaataactactattttatatgatcttaggtctctcaatctaattttccaatggttgtggaaatatatttcatagttatatgtctactc |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27669679 |
ttcaatcaccagaaataactactactttatatgatcttaggtctctcaatctaattttccaatggttgtggaaatatatttcatagttatatgtctactc |
27669778 |
T |
|
| Q |
201 |
actttgagtttagcttttctc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
27669779 |
actttgagtttagcttttctc |
27669799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University