View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13022_high_25 (Length: 292)
Name: NF13022_high_25
Description: NF13022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13022_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 6 - 257
Target Start/End: Complemental strand, 297924 - 297673
Alignment:
| Q |
6 |
agtgagatgaacagcagtgttgttgttagagacgaggggctggaaatgatgatcagattcgcgagttcttctgcgaaaggaaccattatcaggtcccaat |
105 |
Q |
| |
|
||||| |||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
297924 |
agtgacatgagcagcagtgttgtttttagagacgaggggctggaaatgatgatcagattcgcgagttcttctgcgaaaggaaccattatcaggtcccaat |
297825 |
T |
 |
| Q |
106 |
agcaaacactttgagctatctgaatgttgtaataaggtgttcatgtgctcaaacttttgctttctgctgattgcgccaatgatatatggaatcaaacctt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
297824 |
agcaaacactttgagctatctgaatgttgtaataaggtgttaatgtgctcaaacttttgctttctactgattgcgccaatgatatatggaatcaaacctt |
297725 |
T |
 |
| Q |
206 |
ccattgctatctcttcaataaatgatcacagtcttcttagttattccaaatt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
297724 |
ccattgctatctcttcaataaatgatcacagtcttcttagttattccaaatt |
297673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University