View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13022_high_27 (Length: 250)
Name: NF13022_high_27
Description: NF13022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13022_high_27 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 38568733 - 38568970
Alignment:
| Q |
13 |
aatattattgttgtgtctgcagattcggttttactgtttgcaaaacagaggaagcggcgcgtcgttgatggcaaaagcagctatgaaatctcacgcaccg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38568733 |
aatattattgttgtgtctgcagattcggttttactgtttgcaaaacagaggaagcggcgcgtcgttgatggcaaaagcagctatgaaatctcacgcaccg |
38568832 |
T |
|
| Q |
113 |
tctttgtattcattggcagtgattcagttcaatggaagcggaggaacaaaaaacgacaaagatttacgcgccggtgttgctttatgtgcacgcgctgcat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38568833 |
tctttgtattcattggcagtgattcagttcaatggaagcggaggaacaaaaaacgacaaagatttacgcgccggtgttgctttatgtgcacgcgctgcat |
38568932 |
T |
|
| Q |
213 |
ttctcggtcacatcgacggtttacgtgagcttggtcat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38568933 |
ttctcggtcacatcgacggtttacgtgagcttggtcat |
38568970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 30 - 99
Target Start/End: Complemental strand, 34683885 - 34683816
Alignment:
| Q |
30 |
tgcagattcggttttactgtttgcaaaacagaggaagcggcgcgtcgttgatggcaaaagcagctatgaa |
99 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| ||||| || ||| | ||||| ||||| || ||||| |
|
|
| T |
34683885 |
tgcagattcgattctactgtttgcaaaacagagggagcggtgcatcgcttatggcgaaagctgcaatgaa |
34683816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University