View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13022_low_17 (Length: 412)
Name: NF13022_low_17
Description: NF13022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13022_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 15328683 - 15328387
Alignment:
| Q |
1 |
ctgatattaaaatgcctcaaatcctttctccacggcccatgtaggagaaaacaaacgtggatgcaatggaatgaaacaattagagttccaagtccataac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| | |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15328683 |
ctgatattaaaatgcctcaaatcctttccccacagtccatgtaggaaaaaacaaacgtggatgcaatggaatgaaacaattagagttccaagtccttaac |
15328584 |
T |
 |
| Q |
101 |
tttaaagcccttgtattg-ttttcccctccaactatcttaatttagcattcatcatcaaacttctttgctacttggtatgaatgatatcatatgtgacaa |
199 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
15328583 |
tttaaagcccttatattgtttttcccctccaactatcttaatttagcattcatcatcaaacttctttgctacttagtatgaatgatatcatacgtgacaa |
15328484 |
T |
 |
| Q |
200 |
gacaaagcatgtaaagtgtttctcacctt-gattttctgtgatcttcaaatgttaccaattaccaaatatgagaaacatttacaaagtgatcttcaaaat |
298 |
Q |
| |
|
||||||||| ||||||||||| |||| || | || || | | ||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
15328483 |
gacaaagcacgtaaagtgtttttcactttctaattgct-tca--gtcaaatgttaccaattaccaaatatgacaaacattttcaaagtgatcttcaaaat |
15328387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 367 - 404
Target Start/End: Complemental strand, 15328318 - 15328281
Alignment:
| Q |
367 |
gtatgtaggcagtttgggtcattgttatgtgttgttga |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15328318 |
gtatgtaggcagtttgggtcattgttatgtgttgttga |
15328281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University