View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13022_low_25 (Length: 310)
Name: NF13022_low_25
Description: NF13022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13022_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 7e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 73 - 294
Target Start/End: Original strand, 9831111 - 9831328
Alignment:
| Q |
73 |
acacatacaactgtgaggtgctggacttactaatcataagcatgcaattttgatgttaaattttgcatnnnnnnntaatttctcctaactttttagattc |
172 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||| |||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9831111 |
acacatacaactttgaggtgctggacttgctaatcataaacatgcaatgttgatgttaaattttgcatcaaaaa-taatttctcctaactttttagattc |
9831209 |
T |
|
| Q |
173 |
tctaaaatgcatnnnnnnnnnnnnnnntgggttggttaagtggtaatgttgagtatgaatgaatgagaagtttggtatggtatatggtagtagttggtta |
272 |
Q |
| |
|
||||||||| || |||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9831210 |
tctaaaatgtataaaaaaagcaaaaagatggttggttaagtggta-tgttgagtatgaatgaatgagaagtttggtatggtat--ggtagtagttggtta |
9831306 |
T |
|
| Q |
273 |
gatttagacatgatcaacaaaa |
294 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
9831307 |
gatttagacatgatcaacaaaa |
9831328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University