View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13022_low_26 (Length: 303)
Name: NF13022_low_26
Description: NF13022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13022_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 9 - 284
Target Start/End: Complemental strand, 49298488 - 49298223
Alignment:
| Q |
9 |
gagatgaagtgaatgtgagctatggtatagtgatggagatatagatgtgatcatatctttctgtttagaaacttttttgttaccgatatcattgtatatg |
108 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
49298488 |
gagatgaagtgaatatgagctatggtatagtgatggagatatagatgttatcatatctttctgtttagaaacttttttgttatcga-atcattgtatatg |
49298390 |
T |
 |
| Q |
109 |
tnnnnnnnnnnnnnnnntgtcgtcaatatttgaacgagtgtaaactctaatgactattttgaccctgtgaataatgttattgaaatgactctcttaaccg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
49298389 |
gaggggggcacc------gtcgtcaatatttgaacgagtgtaaactctaatgactattttgaccctgtgaat---gtaattgaaatgactctcttaaccg |
49298299 |
T |
 |
| Q |
209 |
cgtgaggatcatgatcaaaaacgaaaaaggtattaacttgatttcccgcccaaaacagggaagttttgcacggaat |
284 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49298298 |
cgtgaggatcatgatcgaaaacgaaaaaggtattaacttgatttcccgcccaaaacagggaagttttgcacggaat |
49298223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University