View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13023_low_5 (Length: 389)
Name: NF13023_low_5
Description: NF13023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13023_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 2e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 6695899 - 6695726
Alignment:
| Q |
1 |
aaaatgaaaattgaaaagatggaacaaagaagggtgtatagtctaatcataaccatcatttcttataatcacgtactacttgatataatgtaaaagccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6695899 |
aaaatgaaaattgaaaagatggaacaaagaagggtgtatagtctaatcataaccatcatttcttataatcacgtactacttgatataatgtaaaagccat |
6695800 |
T |
 |
| Q |
101 |
cattcatatatataattaggttaatcatgggtcatggctaattataatgtgaattgacatatttccattgtcac |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6695799 |
cattcatatatataattaggttaatcatgggtcatggctaattataatgtgaattgacatatttccattgtcac |
6695726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 275 - 389
Target Start/End: Complemental strand, 6695626 - 6695512
Alignment:
| Q |
275 |
tactattgcagatagagataacatgcagaggacaacaacttttacctttcttaacgttgcagcatgtgagagataatatttggacaccaagggacaccac |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6695626 |
tactattgcagatagagataacatgcagaggacaacaacttttacctttcttaacgttgcagcatgtgagagataatatttggacaccaagggacaccac |
6695527 |
T |
 |
| Q |
375 |
aacaaggcctttgct |
389 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
6695526 |
aacaagacctttgct |
6695512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University