View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13024_high_14 (Length: 236)
Name: NF13024_high_14
Description: NF13024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13024_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 46355708 - 46355925
Alignment:
| Q |
1 |
aagaacaaactggtaaactgatttctaatgaaactaattttaaaggtttctagtcttcaaatccttgtccannnnnnnngtttcttttgcggcatcgtnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46355708 |
aagaacaaactggtaaactgatttctaatgaaactaattttaaaggtttctagtcttcaaatccttgtccgttttttttgtttcttttgcggcatcgtaa |
46355807 |
T |
|
| Q |
101 |
nnnnnttgcatggatccaatgtgtagaacgagggaatcacacacattatttacaccaaatatacaaggtattggtttactggtccataaacttgaagaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46355808 |
aaaaattgcatggatccaatgtgtagaacgagggaatcacacacattatttacaccaaatatacaaggtattggtttactggtccataaacttgaagaat |
46355907 |
T |
|
| Q |
201 |
aattcaggtgtgcatatt |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
46355908 |
aattcaggtgtgcatatt |
46355925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University